virusrose200320 virusrose200320

01-12-2016
Mathematics

contestada

Solve for e. (-7) = e/3 + 14

Respuesta :

01-12-2016

(-7) = e/3 + 14

Subtract 14 on both sides

-7 - 14 = e/3 + 14 - 14

-21 = e/3

Multiply by 3 on both sides

-21 * 3 = e/3 * 3

-63 = e

Answer Link

Otras preguntas

how can you determine the diameter of water

I’ll bet you nobody’s not gonna answer this question

What is the narrator trying to persuade his readers to believe in "The Tell- Tale Heart" (with evidence from the text)

Explain the three levels of government in India. I'll give 26 points!

help pleaseeee!!! i’ll give brainly

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

Please help due today

"you all have not done well in the examination" in direct speech

A cylinder has the volume of 300cm cubed and a height of 10cm what is the radius of the cylinder

WILL GIVE YOU WHAT EVER YOU WANT JUST HELP ME Which of the following best compares the structures in protists and fungi that allow these organisms to explore th